ID: 1180183750_1180183762

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1180183750 1180183762
Species Human (GRCh38) Human (GRCh38)
Location 21:46129502-46129524 21:46129540-46129562
Sequence CCCGCCCAGCCGGGCTGGGCCCT TTCCCAGGGCTGCCCCCGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 479} {0: 1, 1: 0, 2: 5, 3: 22, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!