ID: 1180186183_1180186195

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1180186183 1180186195
Species Human (GRCh38) Human (GRCh38)
Location 21:46140513-46140535 21:46140566-46140588
Sequence CCGTCCACCTTCGCATTGCTCAG TCCACCTTCACGTGGCTCACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 16, 4: 179} {0: 6, 1: 2, 2: 2, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!