ID: 1180228603_1180228612

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1180228603 1180228612
Species Human (GRCh38) Human (GRCh38)
Location 21:46413079-46413101 21:46413103-46413125
Sequence CCCACCCGGGAGAGGCTGGACAC CGGCAGCAAGGTGTGGGGAGCGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 8, 4: 120} {0: 4, 1: 3, 2: 6, 3: 290, 4: 2194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!