ID: 1180432217_1180432226

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1180432217 1180432226
Species Human (GRCh38) Human (GRCh38)
Location 22:15263416-15263438 22:15263465-15263487
Sequence CCCATACTGGCGACTGCACAGTC GGCGCGAGCCAAGGAAGAGCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 2, 4: 49} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!