ID: 1180455642_1180455650

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1180455642 1180455650
Species Human (GRCh38) Human (GRCh38)
Location 22:15511297-15511319 22:15511316-15511338
Sequence CCAGTCCCTCCCTGGCGGCTGCG TGCGGAGCCGTCCGAGGACAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!