ID: 1180664541_1180664552

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1180664541 1180664552
Species Human (GRCh38) Human (GRCh38)
Location 22:17499382-17499404 22:17499425-17499447
Sequence CCAAACCCCTTTTCCGTGCTCTG AGTCTCCGTGTGGAGCCATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 279} {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!