ID: 1180669392_1180669393

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1180669392 1180669393
Species Human (GRCh38) Human (GRCh38)
Location 22:17541674-17541696 22:17541702-17541724
Sequence CCTGATGCGGGTGAGCACGTGTG AGTCTCCCTGTCTCCAGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89} {0: 1, 1: 0, 2: 12, 3: 130, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!