ID: 1180757612_1180757617

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1180757612 1180757617
Species Human (GRCh38) Human (GRCh38)
Location 22:18173582-18173604 22:18173602-18173624
Sequence CCTCTGGGATAAGCATGACCAAG AAGTTTAAACACAGGGACAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 191} {0: 2, 1: 0, 2: 2, 3: 14, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!