ID: 1180783506_1180783521

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1180783506 1180783521
Species Human (GRCh38) Human (GRCh38)
Location 22:18534702-18534724 22:18534753-18534775
Sequence CCATCCTCCCTTTGTTCAGGCCG CAGCAGGGAGCCTGTCAGCCCGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 49, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!