ID: 1180796872_1180796875

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1180796872 1180796875
Species Human (GRCh38) Human (GRCh38)
Location 22:18610207-18610229 22:18610234-18610256
Sequence CCTGGTAGGGGCAGCCTGCACGC GCTGCTTGTTCTCCGCTTGCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 118} {0: 1, 1: 2, 2: 0, 3: 7, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!