ID: 1180831002_1180831011

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1180831002 1180831011
Species Human (GRCh38) Human (GRCh38)
Location 22:18906100-18906122 22:18906145-18906167
Sequence CCGGGGAGCAGGAAGGTATGAGC TGCAGCCACCACGGAGGGACGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 23, 4: 216} {0: 2, 1: 0, 2: 3, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!