ID: 1180850712_1180850716

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1180850712 1180850716
Species Human (GRCh38) Human (GRCh38)
Location 22:19018690-19018712 22:19018713-19018735
Sequence CCCACAGGGGCCTAAATGCAGAC TGTGCATCCCCGGTGCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 29, 3: 5, 4: 90} {0: 1, 1: 0, 2: 28, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!