ID: 1180906856_1180906860

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1180906856 1180906860
Species Human (GRCh38) Human (GRCh38)
Location 22:19419665-19419687 22:19419679-19419701
Sequence CCTCAGGACCCAGAGCTGTGGCT GCTGTGGCTTGGCACATAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!