ID: 1180980758_1180980765

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1180980758 1180980765
Species Human (GRCh38) Human (GRCh38)
Location 22:19877005-19877027 22:19877027-19877049
Sequence CCTGTCCTCAAACAGAGCCAGCC CCCACCTGCATACCTGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 240} {0: 1, 1: 0, 2: 2, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!