ID: 1180987723_1180987727

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1180987723 1180987727
Species Human (GRCh38) Human (GRCh38)
Location 22:19915239-19915261 22:19915281-19915303
Sequence CCAGTAGCAATGATGATGTGATC GGAGAAAAAGAGAAAGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 85} {0: 1, 1: 0, 2: 4, 3: 50, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!