ID: 1180997724_1180997728

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1180997724 1180997728
Species Human (GRCh38) Human (GRCh38)
Location 22:19973753-19973775 22:19973780-19973802
Sequence CCGCGCTCTTTGCGCACTGTGGC ATGTACGTGGCCCACTGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67} {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!