ID: 1181023785_1181023792

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1181023785 1181023792
Species Human (GRCh38) Human (GRCh38)
Location 22:20116611-20116633 22:20116636-20116658
Sequence CCCTGTGTGGGGACAGATGGGGT TAGGGTGAGGACTAGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238} {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!