ID: 1181075737_1181075739

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1181075737 1181075739
Species Human (GRCh38) Human (GRCh38)
Location 22:20375548-20375570 22:20375565-20375587
Sequence CCGGCTGTCCTGCATCTTCTCCA TCTCCAGCAGCAGAAGCATCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 50, 4: 433} {0: 2, 1: 0, 2: 5, 3: 38, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!