ID: 1181102532_1181102537

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1181102532 1181102537
Species Human (GRCh38) Human (GRCh38)
Location 22:20551016-20551038 22:20551050-20551072
Sequence CCTTCTTTACAGATAGTGCAAAG CACCCACGGCTGCCTCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 316} {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!