ID: 1181104299_1181104301

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1181104299 1181104301
Species Human (GRCh38) Human (GRCh38)
Location 22:20564463-20564485 22:20564502-20564524
Sequence CCAGCAGGTGGCGCTGCAGCAGC GTTCCAGCAGCAGCAGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 140, 4: 478} {0: 1, 1: 1, 2: 23, 3: 155, 4: 875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!