ID: 1181128105_1181128110

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1181128105 1181128110
Species Human (GRCh38) Human (GRCh38)
Location 22:20713485-20713507 22:20713511-20713533
Sequence CCCCAGCAATCTTGGGGATCACT TCAAAACCCCAAGGAGGCCAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 10, 4: 142} {0: 3, 1: 0, 2: 0, 3: 18, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!