ID: 1181236082_1181236084

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1181236082 1181236084
Species Human (GRCh38) Human (GRCh38)
Location 22:21448379-21448401 22:21448397-21448419
Sequence CCCTCATCTTGGTAATTAGCCAG GCCAGCCTCAGATACTTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 497} {0: 1, 1: 1, 2: 1, 3: 18, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!