ID: 1181277038_1181277043

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1181277038 1181277043
Species Human (GRCh38) Human (GRCh38)
Location 22:21693860-21693882 22:21693881-21693903
Sequence CCATCTTTGGACGGTAAGGGAAG AGCGGCTGTGTGAAGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 125} {0: 1, 1: 0, 2: 0, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!