ID: 1181550930_1181550937

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1181550930 1181550937
Species Human (GRCh38) Human (GRCh38)
Location 22:23638815-23638837 22:23638860-23638882
Sequence CCTTCCAGGTCACCATCAAGATT ACACACCAGTGTGGCCTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 16, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!