ID: 1181577366_1181577373

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181577366 1181577373
Species Human (GRCh38) Human (GRCh38)
Location 22:23803461-23803483 22:23803499-23803521
Sequence CCCTGTGTGTTACGTGGGAACAG GCTGCCTGTCAGGCAGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102} {0: 1, 1: 0, 2: 1, 3: 11, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!