ID: 1181699067_1181699075

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1181699067 1181699075
Species Human (GRCh38) Human (GRCh38)
Location 22:24609723-24609745 22:24609759-24609781
Sequence CCCTCTTCCCTGTTGTCACACCT ATAGCCATGAGACTTCCCAAGGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 0, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!