|
Left Crispr |
Right Crispr |
Crispr ID |
1181729998 |
1181730005 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
22:24838252-24838274
|
22:24838298-24838320
|
Sequence |
CCGATCACTGAGATGACAAGTAT |
GGGTGCTGCAGCTGAAGAGAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 14, 1: 29, 2: 84, 3: 147, 4: 380} |
{0: 3, 1: 44, 2: 93, 3: 200, 4: 594} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|