ID: 1181729998_1181730005

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1181729998 1181730005
Species Human (GRCh38) Human (GRCh38)
Location 22:24838252-24838274 22:24838298-24838320
Sequence CCGATCACTGAGATGACAAGTAT GGGTGCTGCAGCTGAAGAGAAGG
Strand - +
Off-target summary {0: 14, 1: 29, 2: 84, 3: 147, 4: 380} {0: 3, 1: 44, 2: 93, 3: 200, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!