ID: 1181803552_1181803562

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1181803552 1181803562
Species Human (GRCh38) Human (GRCh38)
Location 22:25362001-25362023 22:25362027-25362049
Sequence CCCCTCAACATCATGTGGCCATG CCACAGTCACAATCCGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142} {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!