ID: 1181934635_1181934649

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1181934635 1181934649
Species Human (GRCh38) Human (GRCh38)
Location 22:26429644-26429666 22:26429694-26429716
Sequence CCCGGGCGCCCGCATCCCGGCCC AGCGCCGCCGCCTCGGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 400} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!