ID: 1181957910_1181957921

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1181957910 1181957921
Species Human (GRCh38) Human (GRCh38)
Location 22:26601708-26601730 22:26601747-26601769
Sequence CCCCAGAGGAATAGAGCTCTGTT CAGCACTGGGAGACTGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 169} {0: 1, 1: 1, 2: 11, 3: 147, 4: 783}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!