ID: 1182051018_1182051027

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1182051018 1182051027
Species Human (GRCh38) Human (GRCh38)
Location 22:27313005-27313027 22:27313045-27313067
Sequence CCCTACCCCTGAACCTAATTCAG CAATACAAGGTCTGAGCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124} {0: 1, 1: 0, 2: 2, 3: 5, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!