ID: 1182237009_1182237023

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1182237009 1182237023
Species Human (GRCh38) Human (GRCh38)
Location 22:28883829-28883851 22:28883870-28883892
Sequence CCGCCCCCGCGGCCTCCGGTGCA CGCCGCTGCCGCTGCTGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 320} {0: 2, 1: 3, 2: 13, 3: 112, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!