ID: 1182253867_1182253870

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1182253867 1182253870
Species Human (GRCh38) Human (GRCh38)
Location 22:29023842-29023864 22:29023862-29023884
Sequence CCATGCCTGCCTGATAGCTGGGT GGTGCCTCTTGAGCCAATGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 254} {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!