ID: 1182321571_1182321579

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1182321571 1182321579
Species Human (GRCh38) Human (GRCh38)
Location 22:29481265-29481287 22:29481301-29481323
Sequence CCCTCTGCAAAGTGCATGCCCCT TTTTACTCTGGGTCTCTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 232} {0: 1, 1: 0, 2: 0, 3: 11, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!