ID: 1182403683_1182403692

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1182403683 1182403692
Species Human (GRCh38) Human (GRCh38)
Location 22:30105285-30105307 22:30105317-30105339
Sequence CCCGCATGAACTTGGTGTGTTTG CTGCGATGGCAGCTGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 15, 4: 139} {0: 1, 1: 0, 2: 3, 3: 24, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!