ID: 1182475709_1182475719

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1182475709 1182475719
Species Human (GRCh38) Human (GRCh38)
Location 22:30575249-30575271 22:30575289-30575311
Sequence CCTGGCCTTTCCTTCTTCACCCC GATGAGGACCAATGCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 55, 4: 509} {0: 1, 1: 0, 2: 3, 3: 16, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!