ID: 1182566577_1182566587

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1182566577 1182566587
Species Human (GRCh38) Human (GRCh38)
Location 22:31204600-31204622 22:31204644-31204666
Sequence CCTACATCCGTGGCAGGGCTCTG ACTCCTGGTGTTTGGCTTCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 120} {0: 2, 1: 0, 2: 2, 3: 14, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!