ID: 1182575195_1182575203

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1182575195 1182575203
Species Human (GRCh38) Human (GRCh38)
Location 22:31268190-31268212 22:31268219-31268241
Sequence CCTCCGGAATGGTGAGTCCCACC CCTGCCAGCAGGGCGAGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61} {0: 1, 1: 1, 2: 5, 3: 16, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!