ID: 1182895451_1182895459

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1182895451 1182895459
Species Human (GRCh38) Human (GRCh38)
Location 22:33855660-33855682 22:33855691-33855713
Sequence CCCTCTGCCCCCAGGAACCACAG CAGTATCTTAGTTTTCGAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!