ID: 1183069534_1183069544

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1183069534 1183069544
Species Human (GRCh38) Human (GRCh38)
Location 22:35386660-35386682 22:35386705-35386727
Sequence CCTGACCTGCTCACTCTGCTTTC CCACATCTATGTGGCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 24, 4: 348} {0: 1, 1: 0, 2: 3, 3: 17, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!