ID: 1183122399_1183122407

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1183122399 1183122407
Species Human (GRCh38) Human (GRCh38)
Location 22:35740114-35740136 22:35740162-35740184
Sequence CCTCATTTGCAAAGAAAGGTGCC CAGAGGGCACACGCTGGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 164} {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!