ID: 1183191636_1183191647

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1183191636 1183191647
Species Human (GRCh38) Human (GRCh38)
Location 22:36325390-36325412 22:36325433-36325455
Sequence CCGCACACGGCACGCCAGTAAGG AAGCTCCCCTGATGGCTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 33} {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!