ID: 1183191779_1183191786

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1183191779 1183191786
Species Human (GRCh38) Human (GRCh38)
Location 22:36326252-36326274 22:36326304-36326326
Sequence CCTTCCAGCCTCAGAAGGGGAGG AGGGCTGCCATGCAAACTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 321} {0: 1, 1: 0, 2: 1, 3: 20, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!