ID: 1183293799_1183293808

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1183293799 1183293808
Species Human (GRCh38) Human (GRCh38)
Location 22:37018625-37018647 22:37018655-37018677
Sequence CCAGGACGCGTCCAGCACCCGCA CCCCAGCTTGCCAGTCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94} {0: 1, 1: 1, 2: 1, 3: 28, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!