ID: 1183301055_1183301063

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1183301055 1183301063
Species Human (GRCh38) Human (GRCh38)
Location 22:37059399-37059421 22:37059446-37059468
Sequence CCCAAACGGGCTGAGCTCAGAGT CACCCGCCTCAGCCTGTGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105} {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!