ID: 1183308352_1183308356

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1183308352 1183308356
Species Human (GRCh38) Human (GRCh38)
Location 22:37096011-37096033 22:37096024-37096046
Sequence CCACCTCGGGGCTCAGCATCAGC CAGCATCAGCCGGCGGTGCTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 182} {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!