ID: 1183308352_1183308362

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1183308352 1183308362
Species Human (GRCh38) Human (GRCh38)
Location 22:37096011-37096033 22:37096059-37096081
Sequence CCACCTCGGGGCTCAGCATCAGC TGAACCAGAAGAAGCAGGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 182} {0: 1, 1: 0, 2: 4, 3: 30, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!