ID: 1183328498_1183328502

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1183328498 1183328502
Species Human (GRCh38) Human (GRCh38)
Location 22:37207029-37207051 22:37207047-37207069
Sequence CCATGCGCGTGACCCTGCGTTCG GTTCGGAGCGCCGCCGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 24} {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!