ID: 1183375457_1183375464

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1183375457 1183375464
Species Human (GRCh38) Human (GRCh38)
Location 22:37462216-37462238 22:37462260-37462282
Sequence CCCAGTATCAGATCCCAGGGTGC TCCGTGTCTGGCACTGTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 124} {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!