ID: 1183415022_1183415029

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1183415022 1183415029
Species Human (GRCh38) Human (GRCh38)
Location 22:37676920-37676942 22:37676948-37676970
Sequence CCCGGACACTTCGAGCAGTGGAG GTCCTCTAACCCGGCTGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!